A new family of Cu(II) and Ni(II) salen complexes was synthesized and fully characterized through various physicochemical methods. Their catalytic activity was evaluated in the phase transfer ??-alkylation reaction of the Schiff bases of D,L-alanine ester and benzaldehyde derivatives. It was found that the introduction of a chlorine atom into the ortho- and para-positions of the phenyl ring of the substrate resulted in an increase in both the chemical yield and the asymmetric induction (ee 66-98%). The highest enantiomeric excess was achieved in the case of a Cu(II) salen complex based on (S,S)-cyclohexanediamine and salicylaldehyde at -20 °C. The occurrence of a bulky substituent in the ligand present in the complexes led to a drastic decrease in ee and chemical yield. For instance, the introduction of bulky substituents at positions 3 and 5 of the phenyl ring of the catalyst resulted in a complete loss of the stereoselectivity control in the alkylation reaction.

The present work reports the synthesis of new N4-donor compounds carrying p-xylyl spacers in their structure. Different Schiff base aliphatic N-donors were obtained synthetically and subsequently evaluated for their ability to interact with two models of nucleic acids: calf-thymus DNA (CT-DNA) and the RNA from yeast Saccharomyces cerevisiae (herein simply indicated as RNA). In more detail, by condensing p-xylylenediamine and a series of aldehydes, we obtained the following Schiff base ligands: 2-thiazolecarboxaldehyde (L1), pyridine-2-carboxaldehyde (L2), 5-methylisoxazole-3-carboxaldehyde (L3), 1-methyl-2-imidazolecarboxaldehyde (L4), and quinoline-2-carboxaldehyde (L5). The structural characterisation of the ligands L1-L5 (X-ray, H NMR, C NMR, elemental analysis) and of the coordination polymers {[CuL1]PF} (herein referred to as Polymer1) and {[AgL1]BF} (herein referred to as Polymer2, X-ray, H NMR, ESI-MS) is herein described in detail. The single crystal X-ray structures of complexes Polymer1 and Polymer2 were also investigated, leading to the description of one-dimensional coordination polymers. The spectroscopic and in silico evaluation of the most promising compounds as DNA and RNA binders, as well as the study of the influence of the 1D supramolecular polymers Polymer1 and Polymer2 on the proliferation of Escherichia coli bacteria, were performed in view of their nucleic acid-modulating and antimicrobial applications. Spectroscopic measurements (UV-Vis) combined with molecular docking calculations suggest that the thiazolecarboxaldehyde derivative L1 is able to bind CT-DNA with a mechanism different from intercalation involving the thiazole ring in the molecular recognition and shows a binding affinity with DNA higher than RNA. Finally, Polymer2 was shown to slow down the proliferation of bacteria much more effectively than the free Ag(I) salt.

Physical rehabilitation plays a fundamental role in the management of individuals with disabilities associated with age-related muscle loss or affected by catastrophic conditions such as trauma, surgery, cancer or other severe pathologies. These events have in common an extended period of physical inactivity. Patients who undergo prolonged bed rest often present with a number of complications; for example, muscle loss that can exacerbate existing conditions determined by sarcopenia, which in turn greatly limits physical functions. The main scope of this work is to summarize certain key strategies for the physiotherapeutic management of physically inactive patients, regardless of the reason behind their prolonged bed rest, with a particular focus on physical rehabilitation, nutrition and forest-bathing. The importance of correct nutrition in counter-acting the loss of muscle mass and consequent function is explored alongside a description of the main nutrients that are needed for muscle regeneration. From a biomolecular perspective, some specific molecular mechanisms associated with physical rehabilitation are also reported not only in the context of physical therapy, but also within nature-inspired techniques, such as forest-bathing as well as body self-healing. Combining a targeted physiotherapeutic approach with an appropriate diet as well as nature-based therapy could thus help with the recovery of bed ridden patients.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(AC4A) and d(C6) have been attached, in a parallel fashion, to the two linker's edges by their 3 ' or 5 ' ends. The resulting DEL-CROs have been investigated for their capability to form i-motif structures by circular dichroism, poly-acrylamide gel electrophoresis, HPLC-size-exclusion chromatography, and NMR studies. This investigation established that DEL-CROs could form more stable i-motif structures than the corresponding unmodified CROs. In particular, the i-motif formed by DEL-5 '-d(C6)2 resulted stable enough to be detected even at near physiological conditions (37 degrees C, pH 7.0). The results open the way to developing pH-switchable nanocarriers and aptamers based on suitably functionalized DEL-CROs.

The practice of spending time in green areas to gain the health benefits provided by trees is well known, especially in Asia, as 'forest bathing', and the consequent protective and experimentally detectable effects on the human body have been linked to the biogenic volatile organic compounds released by plants. Houseplants are common in houses over the globe and are particularly appreciated for aesthetic reasons as well for their ability to purify air from some environmental volatile pollutants indoors. However, to the best of our knowledge, no attempt has been made to describe the health benefits achievable from houseplants thanks to the biogenic volatile organic compounds released, especially during the day, from some of them. Therefore, we performed the present study, based on both a literature analysis and in silico studies, to investigate whether the volatile compounds and aerosol constituents emitted by some of the most common houseplants (such as peace lily plant, Spathiphyllum wallisii, and iron plant, Aspidistra eliator) could be exploited in 'indoor forest bathing' approaches, as proposed here for the first time not only in private houses but also public spaces, such as offices, hospitals, and schools. By using molecular docking (MD) and other in silico methodologies for estimating vapor pressures and chemico-physical/pharmacokinetic properties prediction, we found that ?-costol is an organic compound, emitted in appreciable amounts by the houseplant Spathiphyllum wallisii, endowed with potential antiviral properties as emerged by our MD calculations in a SARS-CoV-2 M (main protease) inhibition study, together with sesquirosefuran. Our studies suggest that the anti-COVID-19 potential of these houseplantemitted compounds is comparable or even higher than known M inhibitors, such as eugenol, and sustain the utility of houseplants as indoor biogenic volatile organic compound emitters for immunity boosting and health protection.

The coronavirus disease 2019 (COVID-19) is causing major sanitary and socioeconomic issues, yet some locations are less impacted than others. While densely populated areas are likely to favor viral transmission, we hypothesize that other environmental factors could explain lower cases in some areas. We studied COVID-19 impact and population statistics in highly forested Mediterranean Italian regions versus some northern regions where the amount of trees per capita is much lower. We also evaluated the affinity of Mediterranean plant-emitted volatile organic compounds (VOCs) isoprene, ?-pinene, linalool and limonene for COVID-19 protein targets by molecular docking modeling. Results show that while mean death number increased about 4 times from 2020 to 2021, the percentage of deaths per population (0.06-0.10%) was lower in the greener Mediterranean regions such as Sardinia, Calabria and Basilica versus northern regions with low forest coverage, such as Lombardy (0.33%) and Emilia Romagna (0.29%). Data also show that the pandemic severity cannot be explained solely by population density. Modeling reveals that plant organic compounds could bind and interfere with the complex formed by the receptor binding domain of the coronavirus spike protein with the human cell receptor. Overall, our findings are likely explained by sea proximity and mild climate, Mediterranean diet and the abundance of non-deciduous Mediterranean plants which emit immunomodulatory and antiviral compounds. Potential implications include 'forest bathing' as a therapeutic practice, designing nasal sprays containing plant volatile organic compounds, and preserving and increasing forest coverage.

Strengthening the immune system in order to better withstand the threat of COVID-19 is an important way to ensure the protection of our health against the current pandemic associated with SARS-CoV-2. There are many ways to achieve this, but with current circumstances, certain modalities stand out as being the most valid and are certainly worth greater consideration. Here we review the effects that particular immuno-strengthening activities can have on limiting the severity of COVID-19 disease as well as preventing virus infection. Physical activity, in particular, should not be discounted as an important method of prevention of viral diseases as it triggers many biological processes within the human body which in turn lead to heightened natural defences against viral infections. When exercise is performed in forested areas, these protective health benefits may be increased since many plant species emit biogenic volatile compounds (VOCs) which, when inhaled, have many protective properties. These VOCs have been shown in particular to have immunostimulatory effects on the human body and, thus, they could be of use in the prevention and/or treatment of COVID-19. Being amongst trees may also help to alleviate stress and anxiety, lowering cortisol levels and consequently helping the proper functioning of the immune system. In the following work, we have performed an analysis of the available scientific literature which looks at the effects of physical exercise as well as 'forest-bathing' on the immune system's ability to fight disease, especially of course as it relates to COVID-19. Our review aims at shedding light on the benefits of exercising outdoors in green areas and suggests reforestation as a protective measure against future outbreaks.

Benzofuran derivatives are synthetic compounds that are finding an increasing interest in the scientific community not only as building blocks for the realization of new materials, but also as potential drugs thanks to their ability to interact with nucleic acids, interfere with the amyloid peptide aggregation and cancer cell cycle. However, their ability to interact with proteins is a theme still in need of investigation for the therapeutic importance that benzofurans could have in the modulation of protein-driven processes and for the possibility of making use of serum albumins as benzofurans delivery systems. To this scope, we investigated the protein binding ability of two 4-nitrophenyl-functionalized benzofurans previously synthesized in our laboratory and herein indicated as BF1 and BDF1, which differed for the number of furan rings (a single moiety in BF1, two in BDF1), using bovine serum albumin (BSA) as a model protein. By circular dichroism (CD) spectroscopy we demonstrated the ability of the two heteroaromatic compounds to alter the secondary structure of the serum albumin leading to different consequences in terms of BSA thermal stability with respect to the unbound protein (?Tm > 3 °C for BF1, -0.8 °C for BDF1 with respect to unbound BSA, in PBS buffer, pH 7.5) as revealed in our CD melting studies. Moreover, a molecular docking study allowed us to compare the possible ligand binding modes of the mono and difuranic derivatives showing that while BF1 is preferentially housed in the interior of protein structure, BDF1 is predicted to bind the albumin surface with a lower affinity than BF1. Interestingly, the different affinity for the protein target predicted computationally was confirmed also experimentally by fluorescence spectroscopy (kD = 142.4 ± 64.6 nM for BDF1 vs. 28.4 ± 10.1 nM for BF1). Overall, the above findings suggest the ability of benzofurans to bind serum albumins that could act as their carriers in drug delivery applications.

Nucleopeptides are a class of molecules with numerous applications in the field of therapy, diagnostics and biomaterials development. Despite their nucleobase-decorated nature, their binding to natural nucleic acid targets does not necessarily involve all nucleopeptide bases, as we showed in this study. Here, we present a CD study on the interaction of a dithymine-functionalized tetra-L-serine with a homoadenine DNA (dA) reporting an interpretation of the experimental data in light of our computational studies based on molecular docking and molecular dynamics (MD), as well as computer-assisted CD interpretation and simulation of the predicted complex structure. The stoichiometry of the complex, emerged by CD titration, accounted for a 1:2 T:A ratio. Hence, we supposed that binding did not involve a full pairing of the complementary bases but a partial thymines engagement. This hypothesis was sustained by the docking and MD simulations performed on the selected ligand and the complementary target of DNA and RNA, used for comparison. The nucleopeptide bound the DNA through a single A-T recognition involving complementary base-pairing, as well as by some interactions between its backbone (and in particular L-serine OH) and the nucleic acid. Overall, this confirmed that nucleopeptides can interact with nucleic acids leaving some of their nucleobases free for establishing further interactions with other biomolecules or for crosslinking in supramolecular structures in aqueous solution. Nevertheless, even though no typical DNA secondary structure is formed after nucleopeptide-binding, this ligand is able to induce a higher degree of structuration in the random deoxyoligonucleotide target as evidenced by CD, MD and CD simulation.

Old forests containing ancient trees are essential ecosystems for life on earth. Mechanisms that happen both deep in the root systems and in the highest canopies ensure the viability of our planet. Old forests fix large quantities of atmospheric CO2, produce oxygen, create micro-climates and irreplaceable habitats, in sharp contrast to young forests and monoculture forests. The current intense logging activities induce rapid, adverse effects on our ecosystems and climate. Here we review large old trees with a focus on ecosystem preservation, climate issues, and therapeutic potential. We found that old forests continue to sequester carbon and fix nitrogen. Old trees control below-ground conditions that are essential for tree regeneration. Old forests create micro-climates that slow global warming and are irreplaceable habitats for many endangered species. Old trees produce phytochemicals with many biomedical properties. Old trees also host particular fungi with untapped medicinal potential, including the Agarikon, Fomitopsis officinalis, which is currently being tested against the coronavirus disease 2019 (COVID-19). Large old trees are an important part of our combined cultural heritage, providing people with aesthetic, symbolic, religious, and historical cues. Bringing their numerous environmental, oceanic, ecological, therapeutic, and socio-cultural benefits to the fore, and learning to appreciate old trees in a holistic manner could contribute to halting the worldwide decline of old-growth forests.

Humanity may benefit greatly from intact riverine ecosystems not only because they supply water to be used in the most common human activities, but also for the effects that clean rivers can have on human health. Herein, we used a computational approach to show that some phytochemicals produced by riparian plants as secondary metabolites, which are naturally released into river waters, can have therapeutic properties. These include antipsoriatic activities which we demonstrated in silico by modelling the interaction of apiin, guanosine and hyperoside, a few main river plant metabolites, with NF-kB, IL-17 and IL-36, which are recognized targets involved in psoriasis disease. In particular, we found that apiin and hyperoside are endowed with docking energies and binding affinities which are more favorable than the known reference inhibitors of the three protein targets whilst, in silico, guanosine shows comparable activity with respect to the inhibitors of IL-36 and NF-kB. The low skin permeation (logKp < -8) we predicted for apiin and hyperoside led us to hypothesize their possible utilization as topic antipsoriatic therapeutics, and in particular after PAINS (pan-assay interference compounds) score evaluation, we reached the conclusion that apiin, with no predicted tendency to react nonspecifically with the numerous targets involved in the biological cellular pathways, is particularly interesting for the desired therapeutic application.

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appro-priate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense-and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic.

Trans-polydatin (tPD), the 3-?-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and im-munoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spec-trum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Ancient trees are living ecosystems crucial for the maintenance of life on earth. In fact, old plants and shrubs provide a continuous source of oxygen, food and wood essential for humans, animals and many microorganisms. Besides these benefits, old plants hold an incredible array of medicinal compounds as well as being an ideal breeding ground for other medicinally significant organisms. It is well known that old trees host several species of fungi with documented as well as potentially new therapeutic effects. Polypore mushrooms, recognized within models for environmental and conservation studies, have been widely employed in medicine over the last millennia for their anticancer, antibacterial, anti-inflammatory and antiviral properties

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1?-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (? + ? = +23.6%, ? = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1?-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the ?-helix structure with the concomitant increase in the ?-structure are consistent with a partial protein destabilization due to the interaction with U2O.

The successive lockdowns of the coronavirus 2019 pandemic have substantially increased citizens will to escape from the city and seek out nature for walking, cycling, swimming and other health-enhancing activities. While the heatlh benefits of bathing in natural rivers is empirically known since ancient times, wild swimming is actually booming as never before, partly in response to the lockdowns imposed by the coronavirus 2019 (COVID-19) pandemic. In the United Kingdom, the vogue for taking a cold plunge can be traced back to 1587 when a Cambridge don suggested using pigs' bladders for water wings (Macintyre 2021). In France, king Henry IV (1553-1610), also known as the Green Gallant, enjoyed cold bathing in Paris, which marks the start of wild swimming in the Seine river by a rising population after 1600 (Duhau 2007). Humans benefit enormously from the positive effects of clean rivers on human health. Good quality river waters together with good biodiversity and a riparian habitat structure all concur to create such a positive practice. There is quantitative evidence for the relaxing effect of the sounds made by rivers. Moreover, riparian vegetation can boost human immunity after inhalation of plant-emitted volatile organic compounds. River waters carry plant metabolites that are known ingredients of traditional medicines which induce, among other beneficial effects, antipsoriatic healing. Protecting river ecosystems and improving water quality are therefore challenges worth facing to improve psychological and physical wellness. Here, we present scientific insights on river therapy, aimed at healing both psychological stress and physical disease.

Willardiine is a nonprotein amino acid containing uracil, and thus classified as nucleobase amino acid or nucleoamino acid, that together with isowillardiine forms the family of uracilylalanines isolated more than six decades ago in higher plants. Willardiine acts as a partial agonist of ionotropic glutamate receptors and more in particular it agonizes the non-N-methyl-D-aspartate (non-NMDA) receptors of L-glutamate: ie. the ?-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) and kainate receptors. Several analogues and derivatives of willardiine have been synthesised in the laboratory in the last decades and these compounds show different binding affinities for the non-NMDA receptors. More in detail, the willardiine analogues have been employed not only in the investigation of the structure of AMPA and kainate receptors, but also to evaluate the effects of receptor activation in the various brain regions. Remarkably, there are a number of neurological diseases determined by alterations in glutamate signaling, and thus, ligands for AMPA and kainate receptors deserve attention as potential neurodrugs. In fact, similar to willardiine its analogues often act as agonists of AMPA and kainate receptors. A particular importance should be recognized to willardiine and its thymine-based analogue AlaT also in the peptide chemistry field. In fact, besides the naturally-occurring short nucleopeptides isolated from plant sources, there are different examples in which this class of nucleoamino acids was investigated for nucleopeptide development. The applications are various ranging from the realization of nucleopeptide/DNA chimeras for diagnostic applications, and nucleoamino acid derivatization of proteins for facilitating protein-nucleic acid interaction, to nucleopeptide-nucleopeptide molecular recognition for nanotechnological applications. All the above aspects on both chemistry and biotechnological applications of willardine/willardine-analogues and nucleopeptide will be reviewed in this work.

The aim of this review article is to summarize the knowledge available to date on prophylaxis achievements in the frame of the fight against Coronaviruses. This work will give an overview of what is reported in the recent literature on vaccines (under investigation or already developed like BNT162b2, mRNA-1273, and ChAdOx1-S) effective against the most pathogenic Coronaviruses (SARS-CoV-1, MERS-CoV-1, and SARS-CoV-2), with of course particular attention paid to those under development or already in use to combat the current COVID-19 (CoronaVIrus Disease 19) pandemic. Our main objective is to make a contribution to the comprehension, even at a molecular level, of what is currently ready for anti-SARS-CoV-2 prophylactic intervention, as well as to provide the reader with an overall picture of the most innovative approaches for the development of vaccines that could be of general utility in the fight against the most pathogenic Coronaviruses.

Multivalent molecules are a potential group of bioactive compounds endowed with high affinity and specificity in innovative biomolecule-targeting therapeutic approaches. Herein, we report on a new and versatile N,N,N,N-donor ligand L (1R,4R)-N1,N4-bis(quinolin-2-ylmethylene)cyclohexane-1,4-diamine with two coordinating quinoline moieties connected with trans-1,4-diaminocyclohexane. It coordinates Cu forming a [2 × 2] square grid-type complex C1 [CuL] and Ni giving a triangle-type complex C2 [NiL]. We screened their potential as versatile metal-based Serum Albumin (SA), double helical and G-quadruplex DNA binders taking advantage of their shape, size and stability effects using different spectroscopic experiments (UV-Vis, fluorescence, circular dichroism). The findings of our work suggest the potential utility of the metal complexes herein described in the context of the new drug discovery.

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies. Herein, we describe some G4 structures found in plants, summarizing the existing knowledge of their functions and biological role. Moreover, we review some of the most promising G4 ligands isolated from vegetal sources and report on the known relationships between such phytochemicals and G4-mediated biological processes that make them potential leads in the pharmaceutical sector.