MDM2 is an E3 ubiquitin ligase which is crucial for the degradation and inhibition of the key tumor-suppressor protein p53. In this work, we explored the stability and the conformational features of the N-terminal region of MDM2 (N-MDM2), through which it binds to the p53 protein as well as other protein partners. The isolated domain possessed a native-like conformational stability in a narrow pH range (7.0 to 10.0), as shown by intrinsic and 8-anilinonapthalene-1-sulfonic acid (ANS) fluorescence, far-UV circular dichroism (CD), and size exclusion chromatography (SEC). Guanidinium chloride (GdmCl) denaturation followed by intrinsic and ANS fluorescence, far-UV CD and SEC at physiological pH, and differential scanning calorimetry (DSC) and thermo-fluorescence experiments showed that (i) the conformational stability of isolated N-MDM2 was very low; and (ii) unfolding occurred through the presence of several intermediates. The presence of a hierarchy in the unfolding intermediates was also evidenced through DSC and by simulating the unfolding process with the help of computational techniques based on constraint network analysis (CNA). We propose that the low stability of this protein is related to its inherent flexibility and its ability to interact with several molecular partners through different routes.

Cathelicidins, a family of host defence peptides in vertebrates, play an important role in the innate immune response, exhibiting antimicrobial activity against many bacteria, as well as viruses and fungi. This work describes the design and synthesis of shortened analogues of porcine cathelicidin PMAP-36, which contain structural changes to improve the pharmacokinetic properties. In particular, 20-mers based on PMAP-36 (residues 12-31) and 13-mers (residues 12-24) with modification of amino acid residues at critical positions and introduction of lipid moieties of different lengths were studied to identify the physical parameters, including hydrophobicity, charge, and helical structure, required to optimise their antibacterial activity. Extensive conformational analysis, performed by CD and NMR, revealed that the substitution of Pro25-Pro26 with Ala25-Lys26 increased the ?-helix content of the 20-mer peptides, resulting in broad-spectrum antibacterial activity against Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Staphylococcus epidermidis strains. Interestingly, shortening to just 13 residues resulted in only a slight decrease in antibacterial activity. Furthermore, two sequences, a 13-mer and a 20-mer, did not show cytotoxicity against HaCat cells up to 64 µM, indicating that both derivatives are not only effective but also selective antimicrobial peptides. In the short peptide, the introduction of the helicogenic ?-aminoisobutyric acid forced the helix toward a prevailing 3 structure, allowing the antimicrobial activity to be maintained. Preliminary tests of resistance to Ser protease chymotrypsin indicated that this modification resulted in a peptide with an increased in vivo lifespan. Thus, some of the PMAP-36 derivatives studied in this work show a good balance between chain length, antibacterial activity, and selectivity, so they represent a good starting point for the development of even more effective and proteolysis-resistant active peptides.

Antimicrobial resistance is a major public health concern worldwide. Albeit to a lesser extent than bacteria, fungi are also becoming increasingly resistant to antifungal drugs. Moreover, due to the small number of antifungal classes, therapy options are limited, complicating the clinical management of mycoses. In this view, antimicrobial peptides (AMPs) are a potential alternative to conventional drugs. Among these, Proline-rich antimicrobial peptides (PrAMPs), almost exclusively of animal origins, are of particular interest due to their peculiar mode of action. In this study, a search for new arginine- and proline-rich peptides from plants has been carried out with a bioinformatic approach by sequence alignment and antimicrobial prediction tools. Two peptide candidates were tested against planktonic cells and biofilms of Candida albicans and Candida glabrata strains, including resistant isolates. These peptides showed similar potent activity, with half-maximal effective concentration values in the micromolar range. In addition, some structural and functional features, revealing peculiar mechanistic behaviors, were investigated.

Circular dichroism (CD) spectroscopy is a useful technique for characterizing chiral molecules. It is more sensitive than total absorption to molecule conformation, and it is routinely used to identify enantiomers. We present here absorption and CD spectra within the Time-Dependent (TD) B3LYP approximation in c-GlyPhe, a cyclo-dipeptide containing an aromatic group. Results from codes in localized basis-set (Orca and MolGW) are carefully compared with the novel TD-B3LYP implementation we developed in the Yambo code, that uses a plane-wave basis set.

Nickel exposure is associated with tumors of the respiratory tract such as lung and nasal cancers, acting through still-uncharacterized mechanisms. Understanding the molecular basis of nickel-induced carcinogenesis requires unraveling the mode and the effects of Ni(II) binding to its intracellular targets. A possible Ni(II)-binding protein and a potential focus for cancer treatment is hNDRG1, a protein induced by Ni(II) through the hypoxia response pathway, whose expression correlates with higher cancer aggressiveness and resistance to chemotherapy in lung tissue. The protein sequence contains a unique C-terminal sequence of 83 residues (hNDRG1*C), featuring a three-times-repeated decapeptide, involved in metal binding, lipid interaction and post-translational phosphorylation. In the present work, the biochemical and biophysical characterization of unmodified hNDRG1*C was performed. Bioinformatic analysis assigned it to the family of the intrinsically disordered regions and the absence of secondary and tertiary structure was experimentally proven by circular dichroism and NMR. Isothermal titration calorimetry revealed the occurrence of a Ni(II)-binding event with micromolar affinity. Detailed information on the Ni(II)-binding site and on the residues involved was obtained in an extensive NMR study, revealing an octahedral paramagnetic metal coordination that does not cause any major change of the protein backbone, which is coherent with CD analysis. hNDRG1*C was found in a monomeric form by light-scattering experiments, while the full-length hNDRG1 monomer was found in equilibrium between the dimer and tetramer, both in solution and in human cell lines. The results are the first essential step for understanding the cellular function of hNDRG1*C at the molecular level, with potential future applications to clarify its role and the role of Ni(II) in cancer development.

Trans-polydatin (tPD), the 3-?-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and im-munoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spec-trum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1?-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (? + ? = +23.6%, ? = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1?-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the ?-helix structure with the concomitant increase in the ?-structure are consistent with a partial protein destabilization due to the interaction with U2O.

Herein we describe a combined experimental and in silico study of the interaction of a series of pyrazolo[1,2-a]benzo[1,2,3,4]tetrazin-3-one derivatives (PBTs) with parallel G-quadruplex (GQ) DNA aimed at correlating their previously reported anticancer activities and the stabilizing effects observed by us on c-myc oncogene promoter GQ structure. Circular dichroism (CD) melting experiments were performed to characterize the effect of the studied PBTs on the GQ thermal stability. CD measurements indicate that two out of the eight compounds under investigation induced a slight stabilizing effect (2-4 °C) on GQ depending on the nature and position of the substituents. Molecular docking results allowed us to verify the modes of interaction of the ligands with the GQ and estimate the binding affinities. The highest binding affinity was observed for ligands with the experimental melting temperatures (Tms). However, both stabilizing and destabilizing ligands showed similar scores, whilst Molecular Dynamics (MD) simulations, performed across a wide range of temperatures on the GQ in water solution, either unliganded or complexed with two model PBT ligands with the opposite effect on the Tms, consistently confirmed their stabilizing or destabilizing ability ascertained by CD. Clues about a relation between the reported anticancer activity of some PBTs and their ability to stabilize the GQ structure of c-myc emerged from our study. Furthermore, Molecular Dynamics simulations at high temperatures are herein proposed for the first time as a means to verify the stabilizing or destabilizing effect of ligands on the GQ, also disclosing predictive potential in GQ-targeting drug discovery.

In synthetic peptides containing Gly and coded ?-amino acids, one of the most common practices to enhance their helical extent is to incorporate a large number of l-Ala residues along with noncoded, strongly foldameric ?-aminoisobutyric acid (Aib) units. Earlier studies have established that Aib-based peptides, with propensity for both the 310- and ?-helices, have a tendency to form ordered three-dimensional structure that is much stronger than that exhibited by their l-Ala rich counterparts. However, the achiral nature of Aib induces an inherent, equal preference for the right- and left-handed helical conformations as found in Aib homopeptide stretches. This property poses challenges in the analysis of a model peptide helical conformation based on chirospectroscopic techniques like electronic circular dichroism (ECD), a very important tool for assigning secondary structures. To overcome such ambiguity, we have synthesized and investigated a thermally stable 14-mer peptide in which each of the Aib residues of our previously designed and reported analogue ABGY (where B stands for Aib) is replaced by C?-methyl-l-valine (L-AMV). Analysis of the results described here from complementary ECD and 1H nuclear magnetic resonance spectroscopic techniques in a variety of environments firmly establishes that the L-AMV-containing peptide exhibits a significantly stronger preference compared to that of its Aib parent in terms of conferring ?-helical character. Furthermore, being a chiral ?-amino acid, L-AMV shows an intrinsic, extremely strong bias for a quite specific (right-handed) screw sense. These findings emphasize the relevance of L-AMV as a more appropriate unit for the design of right-handed ?-helical peptide models that may be utilized as conformationally constrained scaffolds.

The guanylyl cyclase-activating protein 1, GCAP1, activates or inhibits retinal guanylyl cyclase (retGC) depending on cellular Ca2+ concentrations. Several point mutations of GCAP1 have been associated with impaired calcium sensitivity that eventually triggers progressive retinal degeneration. In this work, we demonstrate that the recombinant human protein presents a highly dynamic monomer-dimer equilibrium, whose dissociation constant is influenced by salt concentration and, more importantly, by protein binding to Ca2+ or Mg2+. Based on small-angle X-ray scattering data, protein-protein docking, and molecular dynamics simulations we propose two novel three-dimensional models of Ca2+-bound GCAP1 dimer. The different propensity of human GCAP1 to dimerize suggests structural differences induced by cation binding potentially involved in the regulation of retGC activity

Gaining new understanding on the mechanism of action of antimicrobial peptides is the basis for the design of new and more efficient antibiotics. To this aim, it is important to detect modifications occurring to both the peptide and the bacterial cell upon interaction; this will help to understand the peptide structural requirement, if any, at the base of the interaction as well as the pathways triggered by peptides ending in cell death. A limited number of papers have described the interaction of peptides with bacterial cells, although most of the studies published so far have been focused on model membrane-peptides interactions. Investigations carried out with bacterial cells highlighted the limitations connected to the use of oversimplified model membranes and, more importantly, helped to identify molecular targets of antimicrobial peptides and changes occurring to the bacterial membrane. In this review, details on the mechanism of action of antimicrobial peptides, as determined by the application of spectroscopic techniques, as well as scattering, microscopy, and calorimetry techniques, to complex systems such as peptide/bacteria mixtures are discussed.

The antiangiogenic activity of the H/P domain of histidine-proline-rich glycoprotein is mediated by its binding with tropomyosin, a protein exposed on endothelial cell-surface during the angiogenic switch, in presence of zinc ions. Although it is known that copper ion serum concentration is significantly increased in cancer patients, its role in the interaction of H/P domain with tropomyosin, has not yet been studied. In this paper, by using ELISA assay, we determined the modulating effect of TetraHPRG peptide, a sequence of 20 aa belonging to H/P domain, on the binding of Kininogen (HKa) with tropomyosin, both in absence and presence of copper and zinc ions. A potentiometric study was carried out to characterize the binding mode adopted by metal ions with TetraHPRG, showing the formation of complex species involving imidazole amide nitrogen atoms in metal binding. Moreover, circular dichroism showed a conformational modification of ternary systems formed by TetraHPRG, HKa and copper or zinc. Interestingly, slight pH variation influenced the HKa-TetraHPRG-tropomyosin binding. All these results indicate that both metal ions are crucial in the interaction between TetraHPRG, tropomyosin and HKa.

Chiral porphyrin hetero-aggregates, produced from meso-tetrakis(4-N-methylpyridyl) porphyrin H(2)T4 and copper(II) meso-tetrakis(4-sulfonatophenyl)porphyrin CuTPPS by an imprinting effect in the presence of L-3,4-dihydroxyphenylalanine (L-DOPA), are shown herein to serve as templates for the generation of chiral structures during the oxidative conversion of the amino acid to melanin. This remarkable phenomenon is suggested to involve the initial role of L-DOPA and related chiral intermediates like dopachrome as templates for the production of chiral porphyrin aggregates. When the entire chiral pool from DOPA is lost, chiral porphyrin hetero-aggregate would elicit axially chiral oligomer formation from 5,6-dihydroxyindole intermediates in the later stages of melanin synthesis. These results, if corroborated by further studies, may open unprecedented perspectives for efficient strategies of asymmetric melanin synthesis with potential biological and technological applications.

Numerous carrier proteins intervene in protein transport from the cytoplasm to the nucleus in eukaryotic cells. One of those is importin alpha, with several human isoforms; among them, importin alpha 3 (Imp alpha 3) features a particularly high flexibility. The protein NUPR1L is an intrinsically disordered protein (IDP), evolved as a paralogue of nuclear protein 1 (NUPR1), which is involved in chromatin remodeling and DNA repair. It is predicted that NUPR1L has a nuclear localization sequence (NLS) from residues Arg51 to Gln74, in order to allow for nuclear translocation. We studied in this work the ability of intact NUPR1L to bind Imp alpha 3 and its depleted species, increment Imp alpha 3, without the importin binding domain (IBB), using fluorescence, isothermal titration calorimetry (ITC), circular dichroism (CD), nuclear magnetic resonance (NMR), and molecular docking techniques. Furthermore, the binding of the peptide matching the isolated NLS region of NUPR1L (NLS-NUPR1L) was also studied using the same methods. Our results show that NUPR1L was bound to Imp alpha 3 with a low micromolar affinity (similar to 5 mu M). Furthermore, a similar affinity value was observed for the binding of NLS-NUPR1L. These findings indicate that the NLS region, which was unfolded in isolation in solution, was essentially responsible for the binding of NUPR1L to both importin species. This result was also confirmed by our in silico modeling. The binding reaction of NLS-NUPR1L to increment Imp alpha 3 showed a larger affinity (i.e., lower dissociation constant) compared with that of Imp alpha 3, confirming that the IBB could act as an auto-inhibition region of Imp alpha 3. Taken together, our findings pinpoint the theoretical predictions of the NLS region in NUPR1L and, more importantly, suggest that this IDP relies on an importin for its nuclear translocation.

The focus of this paper is on the intermolecular interaction active between polyaniline (PANI) and 10-camphorsulfonic acid (10CSA). Enantiopure 10CSA, present in the electropolymerization solution, promotes chiral induction in the supramolecular polyaniline polymer (cPANI). Tight integration of experimental data (circular dichroism, CD, near edge X-ray absorption spectra, NEXAFS, conductive probe atomic force microscopy, CP-AFM) and theoretical [density functional theory, (DFT)] results allows to unfold the nature of the electronic interaction between PANI and 10CSA and to shed light on the physical interactions inducing the chiral character to bulk pristine non-chiral PANI: eventually yielding cPANI. The electropolymerization follows a "wet chemistry" method: electrochemical polymerization of aniline in the co-presence in bulk solution of enantiopure 10-camphorsulfonic acid (10CSA). The latter is exploited as chirality inductor. The method of integration between experimental results with ab-initio theoretical calculations, strongly suggests that the chiral induction exerted by the CSA stems from exchange interaction between CSA and PANI.

Novel optically active oligothiophenes bearing electron-donating chiral side chains have been prepared by synthetic methods suitable to achieve regioregular head-to-tail and head-to-head/tail-to-tail derivatives. In particular, the chiral (S)-(2-methyl)butyl moiety was linked at position 3 of the thiophene ring through heteroatoms, such as S or O, to evaluate its effect on the macro molecular aggregation and, consequently, on the chiroptical properties of the material in the solid state. The materials have been fully characterized and investigated by optical and chiroptical methods upon aggregation both from the solution and as cast films. Compared with the related head-to-tail and head-to-head/tail-to-tail poly(3-alkyl)thiophene derivatives, with the same optically active moiety directly linked to the ring and possessing a higher polymerization degree, the chiroptical properties of the newly synthesized oligomers were significant, or even better, and provided insight into the role of intrachain-interchain interactions between the heteroatom and the thienyl sulfur atom.

Several carrier proteins are involved in protein transport from the cytoplasm to the nucleus in eukaryotic cells. One of those is importin alpha, of which there are several human isoforms; among them, importin alpha 3 (Imp alpha 3) has a high flexibility. The protein NUPR1, a nuclear protein involved in the cell-stress response and cell cycle regulation, is an intrinsically disordered protein (IDP) that has a nuclear localization sequence (NLS) to allow for nuclear translocation. NUPR1 does localize through the whole cell. In this work, we studied the affinity of the isolated wild-type NLS region (residues 54-74) of NUPR1 towards Imp alpha 3 and several mutants of the NLS region by using several biophysical techniques and molecular docking approaches. The NLS region of NUPR1 interacted with Imp alpha 3, opening the way to model the nuclear translocation of disordered proteins. All the isolated NLS peptides were disordered. They bound to Imp alpha 3 with low micromolar affinity (1.7-27 mu M). Binding was hampered by removal of either Lys65 or Lys69 residues, indicating that positive charges were important; furthermore, binding decreased when Thr68 was phosphorylated. The peptide phosphorylated at Thr68, as well as four phospho-mimetic peptides (all containing the Thr68Glu mutation), showed the presence of a sequential NN(i,i+ 1) nuclear Overhauser effect (NOE) in the 2D-H-1-NMR (two-dimensional-proton NMR) spectra, indicating the presence of turn-like conformations. Thus, the phosphorylation of Thr68 modulates the binding of NUPR1 to Imp alpha 3 by a conformational, entropy-driven switch from a random-coil conformation to a turn-like structure.

The urgent need to develop a detection system forStaphylococcus aureus, one of the most common causes of infection, is prompting research towards novel approaches and devices, with a particular focus on point-of-care analysis. Biosensors are promising systems to achieve this aim. We coupled the selectivity and affinity of aptamers, short nucleic acids sequences able to recognize specific epitopes on bacterial surface, immobilized at high density on a nanostructured zirconium dioxide surface, with the rational design of specifically interacting fluorescent peptides to assemble an easy-to-use detection device. We show that the displacement of fluorescent peptides upon the competitive binding ofS. aureusto immobilized aptamers can be detected and quantified through fluorescence loss. This approach could be also applied to the detection of other bacterial species once aptamers interacting with specific antigens will be identified, allowing the development of a platform for easy detection of a pathogen without requiring access to a healthcare environment.

We probe the origin of photoluminescence of an atomically precise noble metal cluster, Ag24Au1(DMBT)18 (DMBT = 2,4-dimethylbenzenethiolate), and the origin of chirality in its chirally functionalized derivatives, Ag24Au1(R/S-BINAS)x(DMBT)18-2x, with x = 1-7 (R/S-BINAS = R/S-1,1'-[binaphthalene]-2,2'-dithiol), using chiroptical spectroscopic measurements and density functional theory (DFT) calculations. Combination of chiroptical and luminescence spectroscopies to understand the nature of electronic transitions has not been applied to such molecule-like metal clusters. In order to impart chirality to the achiral Ag24Au1(DMBT)18 cluster, the chiral ligand, R/S-BINAS, was incorporated into it. A series of clusters, Ag24Au1(R/S-BINAS)x(DMBT)18-2x, with x = 1-7, were synthesized. We demonstrate that the low-energy electronic transitions undergo an unexpected achiral to chiral and back to achiral transition from pure Ag24Au1(DMBT)18 to Ag24Au1(R/S-BINAS)x(DMBT)18-2x, by increasing the number of BINAS ligands. The UV/vis, luminescence, circular dichroism, and circularly polarized luminescence spectroscopic measurements, in conjunction with DFT calculations, suggest that the photoluminescence in Ag24Au1(DMBT)18 and its chirally functionalized derivatives originates from the transitions involving the whole Ag24Au1S18 framework and not merely from the icosahedral Ag12Au1 core. These results suggest that the chiroptical signatures and photoluminescence in these cluster systems cannot be solely attributed to any one of the structural components, that is, the metal core or the protecting metal-ligand oligomeric units, but rather to their interaction and that the ligand shell plays a crucial role. Our work demonstrates that chiroptical spectroscopic techniques such as circular dichroism and circularly polarized luminescence represent useful tools to understand the nature of electronic transitions in ligand-protected metal clusters and that this approach can be utilized for gaining deeper insights into the structure-property relationships of the electronic transitions of such molecule-like clusters.

The human telomeric G-quadruplex structural motif of DNA has come to be known as a new and stimulating target for anticancer drug discovery. Small molecules that interact with G-quadruplex structures in a selective way have gained impressive interest in recent years as they may serve as potential therapeutic agents. Here, we show how circular dichroism, UV resonance Raman and small angle X-ray scattering spectroscopies can be effectively combined to provide insights into structural and molecular aspects of the interaction between human telomeric quadruplexes and ligands. This study focuses on the ability of berberine and palmatine to bind with human telomeric quadruplexes and provides analysis of the conformational landscape visited by the relevant complexes upon thermal unfolding. With increasing temperature, both free and bound G-quadruplexes undergo melting through a multi-state process, populating different intermediate states. Despite the structural similarity of the two ligands, valuable distinctive features characterising their interaction with the G-quadruplex emerged from our multi-technique approach.